Skip to main content
padlock icon - secure page this page is secure

Novel mutations in MEN1, CDKN1B and AIP genes in patients with multiple endocrine neoplasia type 1 syndrome in Spain

Buy Article:

$59.00 + tax (Refund Policy)

Summary

Context  Multiple endocrine neoplasia type 1 (MEN1) is a rare autosomal dominant disorder mostly owing to a genetic defect in MEN1 gene. Not all patients with MEN1 phenotype present a defect in this gene. Thus, other genes like CDKN and AIP have been showed to be involved in MEN1‐like patients.

Objective  The aim of this study was to perform a genetic screening in our cohort or patients with suspected MEN1 syndrome by direct sequencing analysis of MEN1, CDKN1B and AIP, and dosage analysis of MEN1 and AIP.

Results  A total of 79 different sporadic and familial cases with the MEN1 phenotype have been studied, in which 34 of them (48%) present a mutation in MEN1 gene. In two patients without a detectable mutation in MEN1 gene, we have identified a novel missense mutation (c.163G>A/p.Ala55Thr) in CDKN1B gene and a novel frameshift mutation (c.825_845delCGCGGCCGTGTGGAATGCCCA/p. His275GlnfsX49) in AIP gene, respectively.

Conclusions  Our data support that MEN1 gene is the main target for genetic analysis in clinical MEN1 syndrome. We confirm that in those patients without MEN1 gene mutation, other genes such as CDKN1B/p27Kip, or AIP in those including pituitary tumours should also be tested.
No References
No Citations
No Supplementary Data
No Article Media
No Metrics

Document Type: Research Article

Affiliations: 1: Department of Cell Biology and Histology, University of Basque Country 2: Endocrinology Research group, Cruces’ Hospital, CIBERER, Barakaldo

Publication date: May 1, 2012

  • Access Key
  • Free content
  • Partial Free content
  • New content
  • Open access content
  • Partial Open access content
  • Subscribed content
  • Partial Subscribed content
  • Free trial content
Cookie Policy
X
Cookie Policy
Ingenta Connect website makes use of cookies so as to keep track of data that you have filled in. I am Happy with this Find out more